11 March 2003

Cat = TACTCTTTACCTTTTATTCG: Animal 'bar codes' to take over from Latin names 40 top taxonomists met in NY 9 Mar 03 to propose a DNA-based taxonomy as a replacement for the traditional Latin system, which is apparently suffers from long lead-times (1.2m species have been named in 260 years, with 10m to go), exacerbated by a lack of competent practitioners ("The proper naming of species has become a serious bottleneck" says Prof Hebert). Existing species will get to keep their Latin names - lucky them. 4:16:38 PM     comments

Three SF-related lists: Gibson, Banks, computer names zaibatsu (etc) names from Gibson Sprawl novels List of ship names from Banks Culture novels named computers in SF 4:16:13 PM     comments