|
 |
Thursday, May 01, 2003 |
I seem to be in a very odd mood today. Magic is is in the air. Here are a few pictures of Prince Edward Island or PEI, my adopted home.
  
It really looks like this in the summer.
9:01:43 PM 
|
|
What a photographer!
8:42:51 PM
|
|
A Master!
8:36:18 PM
|
|
FedEx does not equal Overnight. Like "Kleenex" means "tissue" and "Jello" means "gelatin," FedEx, at least in my mind, means "overnight." I always thought the reason we sent things FedEx was so that they would be there the next morning.
Apparently, however, if something is sent from the U.S. to Canada, sending it FedEx means not overnight but rather "in a couple of days." The FedEx International Priority page describes their international service as "time-definite delivery typically in 1, 2 or 3 business days." Their delivery standard for Prince Edward Island is delivery by 5:00 p.m. the 2nd business day.
It seems to me that among the things that restricts Prince Edward Island's economic development this would be at least on the middle of the list. Of course it's not something unique to the Island (although I suspect FedEx parcels to Toronto and Montreal are next-day delivered most often). But Boston is close enough to Prince Edward Island that you can almost spit on it, and to take 48 hours to wing a parcel here seems closer to "forever" than it does to "overnight."
Caveat emptor. [Reinvented News]
Peter introduced me to blogging. He is the King of PEI and his blog is where we go in our small community to hang out.
8:26:47 PM
|
|
The problem with genomes. The link is to the SARS genome. A sample:
ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTG While it is unquestionably amazing how fast the assault on this little piece of killer information is going, you can see that we are in the very earliest of days of understanding biology as information.
We're able to view the bits of the program, like scanning a disk drive at the lowest level. We don't even know what the bytes are yet, and of course have no clue how to understand how it hijacks our human system just by looking at its bits. There is a long way to go before we will be able to look at a genome and see the software and not just the bits.
Presumably the next layer in the protocol stack for biologists is to be able to see what proteins are hijacked by this particular viral string, and know how to intervene. Or perhaps be able to write the "inverse" of the virus - the vaccine - directly to our immune system without having to do any actual testing. Maybe in my lifetime these viruses will become nothing more than yet another stack overflow / release a patch cycle. If we get to that point, terrorists had better learn to concentrate their pathogen creating efforts on internet systems - they'll probably be able to do far more damage to the human experience than through a real virus. [Canadians are smug]
8:18:47 PM
|
|
ON DREAMS, PAIN AND SEX: DARWIN WINS AGAIN.
 I concluded my essay on SARS (no, I won't put the acronym in small letters) with a quote from economist Peter Jay: "Darwin always wins in the end." Three recent news items have caused me to realize just how true that statement is:
- The Purpose of Dreams: Rayne has been posting about Freud's Interpretation of Dreams and asking for alternative theories to his "crap". I'd never miss an opportunity to criticize psychologists. The most plausible explanation to me is that since all animals (even amphibians) have been shown to dream, the purpose of dreams is to imagine alternative scenarios. Any creature that dreams of other ways to handle a particular situation (and most dreams seem to be conceivable variations of potential real-life experiences, rather than pure fantasy) has a stronger arsenal for dealing with that situation if/when it occurs in real life. Hence I'd hypothesize that dreamers should tend to out-survive non-dreamers, and that's why there's so many of us around. This is, I'd guess, especially true of artists.
- The Purpose of Pain: A group of British wacko scientists has been torturing fish to find out if they feel pain, and to no one's surprise concluded they do. Nevertheless, one small group (presumably creationist psychologists) continues to believe that animals other than humans cannot feel pain because they aren't intelligent enough. Can educated people really be this dumb? Isn't it obvious that the purpose of pain is to discourage repeat of the activity that led to it, in the Darwinian interest of survival? Really, I think we need to experiment on this nut group to see if they're intelligent enough to feel pain.
- Why is Sex Fun?: Somewhere in my readings I ran into a book with this title. I haven't read it so I don't know the answer (though if it's written by psychologists, reading it probably wouldn't help). But my instinctive answer would be that this, too, is Darwinian. If something is fun, you want to do it more often, and having sex more often would therefore tend to aid survival of the species. If you're severely stressed and it isn't fun, the cessation of sex under those circumstances would also seem Darwinian. Of course there's always the Klingon alternative of having sex as an irresistable but excruciating imperative. But I think nature has a better sense of humour than that.
Psychologist readers, I'm just kidding in my jabs. Some of my best friends are psychologists, really. I'm an accountant, and turnabout's fair play, so feel free to respond in kind. (How many psychologists does it take to change a lightbulb? None, the lightbulb has to really want to change.) |
[How to Save the World]
Maybe I am in a nationalist mood but I have been struck by a number of exceptionally thoughtful Canadians who are blogging. here is the first of a few highlights - Take it away Dave!
8:16:32 PM
|
|
Thinking about capturing knowledge.
[Curiouser and curiouser!]
Matt - Does your well thought through and elegant diagram suggest that knowledge can be "captured" by some system?
If so I prefer the BP approach where they reject some form of "capture" and see instead that knowledge is most deep and useful in tacit form embedded in a person. So instead of capturing knowledge, BP make it easy to find the person who has the know how.
For instance in my case as a novice blogger, Critt Jarvis has kindly given me the code to set up a category section and a blogroll. Now Richard Gayle is helping me automate the blogroll. This quite different fro say a FAQ which would be the knowledge in "capture" form. For me the novice, being mentored by a person is 10 times better than reading about the technique.
8:10:26 PM
|
|
Tiernan Ray: Why Blogs Haven't Stormed the Business World. [Scripting News]
I see the issue as culture. In a masculine culture, I have to know it all. Real men don't ask for directions. Real men don't have feelings. In a traditional workplace you keep you game face on. Knowledge is power - how can you be doubtful? You don't help others without a n expectation for a direct return.
The blog world is so different from this.
1:12:36 PM
|
|
I am testing RU with Hope
1:04:27 PM
|
|
Testing
1:02:41 PM
|
|
The link to Reuters Health site talks about a new vaccine that does not - repeat not - protect the elderly from Pneumonia. This is obviously seen as being a failure.
My reaction? So what are we meant to die from?. I think think of almost any other death that might be worse than what used to be called "the Old Man's friend". What do we really expect from our health-care system to cure death itself? On PEI Cancer and heart disease are the two top causes of death.
When I first came to the Island full of piss and vinegar and eager to cure the health-care system I had dinner with two doctors - they were middle-aged and married to each other. After hearing me out politely, Elizabeth quietly told me that the biggest problem facing health reform was our attitude to death.
She explained that we as people can no longer seem to accept death as inevitable and hence put onto the medical profession the duty to prevent it all costs. About 50% of our personal lifetime health care dollars are spent in the last year of life as a result. 50% of our costs in the last year! If you want to reduce health-care costs, we have to look at death and our attitude to it.
Her quiet advice has been churning around in me ever since. It was both the sense of what she told me and also the power behind her words. I did not see them again.
Last year just after my wife Robin as diagnosed with breast cancer I learned that Elizabeth had just died of it. When I had had dinner with them all those years ago, she had just been diagnosed herself. Now it all made sense to me. Why I was so struck by her advice. She was giving me this insight from the depths of her soul as she faced her own death and the choices that it created for her and her family. She died with great dignity in palliative care.
In many cases other than accident, we can choose how we die. My concern is that if we put all our faith in the medical bucket that we risk choosing the hardest death of all - the unaware death. Robin and I talk a great deal about how many times and under what circumstances will she go through chemo again. At what point will she take charge and ask the medical profession to step aside are the underlying questions.
7:43:54 AM
|
|
© Copyright 2003 Robert Paterson.
|
|
|
